DNA melting temperature (Tm) calculator

What is the melting temperature of an oligonucleotide?

The melting temperature, Tm, is the temperature at which half of the DNA duplexes in a solution have separated into single strands. For PCR primers and probes it tells you roughly how hot a reaction can be before the oligo stops binding its target. Two things push Tm up: more G–C pairs (three hydrogen bonds each, against two for A–T) and a longer oligo. This calculator gives the quick estimates used on bench sheets, not a thermodynamic prediction.

Which formula does the calculator use, and when?

Below 14 nucleotides it reports the Wallace rule, Tm = 2 × (A+T) + 4 × (G+C) in °C. From 14 nucleotides upward it reports the basic formula, Tm = 64.9 + 41 × (G+C − 16.4) ÷ N, where G+C is the count of G and C bases and N is the length. Both are always shown in the table, so you can compare. Sources disagree about where to switch: vendor pages put the cut-off at 13, 14 or even 25 nucleotides. We use 14, the figure in the sources we could read that give a single rule; if your protocol states a different one, read the other row.

Worked example

Take the 8-mer ATGCATGC: it has 4 A or T and 4 G or C, so the Wallace rule gives 2 × 4 + 4 × 4 = 24 °C. Now the 20-mer TATATGCCCGATCCGCTAGT, used as the example in Gene Link’s technical note: 4 A, 6 T, 4 G and 6 C, so GC content is 50%. The basic formula gives 64.9 + 41 × (10 − 16.4) ÷ 20 = 51.78 °C, while the Wallace rule would give 60 °C, about 8 degrees higher. The gap shows why the Wallace rule is kept for short oligos.

What does the salt-adjusted formula add?

Sodium ions shield the negative phosphate backbone and stabilize the duplex, so Tm rises with salt. The formula Tm = 81.5 + 16.6 × log₁₀[Na⁺] + 0.41 × %GC − 600 ÷ N, which Gene Link attributes to Bolton and McCarthy (1962), includes the sodium concentration in molar units. The calculator evaluates it with the value you enter in millimolar (the default is 50 mM). For the 20-mer above at 50 mM it gives 50.4 °C. Note that it is a different equation from the basic one: its length term is 600 ÷ N rather than the 41 × 16.4 ÷ N ≈ 672 ÷ N used in the basic formula, so the two never agree exactly.

How is the molecular weight calculated?

The weight of a single-stranded DNA oligo is the sum of the average masses of its nucleotide residues minus the terminal phosphate. Residue masses used here are A 313.21, C 289.18, G 329.21 and T 304.20 g/mol; we computed them from the molecular formulas of the deoxynucleotide monophosphates and standard atomic weights, and they match the vendor table within 0.01. Adding the water of the ends and removing a 5′ phosphate (+18.015 − 79.98 = −61.965) gives an oligo with free 5′-OH and 3′-OH. The 20-mer above weighs 6,068 g/mol, so 1 nmol is 6.07 µg. Modified oligos, 5′ phosphates and labels add their own mass.

Limits of these estimates

These formulas ignore the order of the bases: two sequences with the same composition get the same Tm, although stacking energies of neighboring pairs differ. The nearest-neighbor method (for example SantaLucia, 1998) models that and is the standard for PCR primer design, but it needs thermodynamic tables and oligo concentration, and it is not part of this calculator. The simple formulas also assume standard salt and ignore magnesium, DMSO and other additives, which shift Tm in a real PCR mix. Treat the result as a starting point, within a few degrees at best, and check it against your polymerase or kit documentation.

Common mistakes

Pasting a sequence with letters other than A, C, G and T (an RNA U, an N for any base) will be refused instead of silently dropped; these need their own masses and rules. Applying the Wallace rule to a 30-mer gives a number far too high. Reading the Tm as the annealing temperature is the third common error: PCR annealing temperatures are normally set a few degrees below the primer Tm, and the exact rule depends on the polymerase manufacturer, so look it up there.

For research and teaching use only; confirm primer conditions with your polymerase or kit documentation. Sources: Gene Link, technical note “MW and TM calculation” (Tm rules for short and long oligos, the sodium formula attributed to Bolton and McCarthy, 1962, PNAS 48, and the example sequence) — a vendor document, used for formulas only; residue masses computed from molecular formulas and IUPAC atomic weights; the 64.9 formula and the length cut-offs as reported by vendor and community pages. The original papers by Marmur and Doty (1962, J. Mol. Biol. 5:109), Wallace et al. (1979, Nucleic Acids Res. 6:3543) and SantaLucia (1998, PNAS 95:1460) were not opened. Related: molar mass calculator, molarity calculator, dilution calculator, Beer-Lambert law calculator and buffer pH calculator.